ID: 1053667177_1053667183

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1053667177 1053667183
Species Human (GRCh38) Human (GRCh38)
Location 9:40324528-40324550 9:40324570-40324592
Sequence CCAGAGCACTCTTCTGTCTGTAG AGGGAGTCCCATTTCAGGTGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!