ID: 1053678781_1053678785

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1053678781 1053678785
Species Human (GRCh38) Human (GRCh38)
Location 9:40465199-40465221 9:40465224-40465246
Sequence CCTTATACAGGAGTGTTCCTGCT CATCACATCAGTGCCCCTCTGGG
Strand - +
Off-target summary No data {0: 8, 1: 2, 2: 36, 3: 133, 4: 352}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!