ID: 1053678781_1053678790

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1053678781 1053678790
Species Human (GRCh38) Human (GRCh38)
Location 9:40465199-40465221 9:40465244-40465266
Sequence CCTTATACAGGAGTGTTCCTGCT GGGATGGAGCTCAAAAAAGAAGG
Strand - +
Off-target summary {0: 11, 1: 12, 2: 69, 3: 164, 4: 611} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!