ID: 1054087636_1054087640

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1054087636 1054087640
Species Human (GRCh38) Human (GRCh38)
Location 9:60761422-60761444 9:60761447-60761469
Sequence CCCTTGGTGCTGTTCTCATGACA GGGTGCCTTCTCATGAGATCTGG
Strand - +
Off-target summary {0: 22, 1: 146, 2: 334, 3: 744, 4: 978} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!