ID: 1054196593_1054196600

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1054196593 1054196600
Species Human (GRCh38) Human (GRCh38)
Location 9:62038005-62038027 9:62038041-62038063
Sequence CCTTTCTGCCTCACCTTACAAAG TTTGGGATTAATGTTGAGATGGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 2, 3: 44, 4: 453} {0: 3, 1: 0, 2: 0, 3: 19, 4: 283}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!