ID: 1054269236_1054269237

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1054269236 1054269237
Species Human (GRCh38) Human (GRCh38)
Location 9:62952544-62952566 9:62952563-62952585
Sequence CCAGTGTAATGATAACACACACA CACACTGTATAAACAGATATTGG
Strand - +
Off-target summary No data {0: 3, 1: 1, 2: 3, 3: 14, 4: 171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!