ID: 1054282528_1054282537

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1054282528 1054282537
Species Human (GRCh38) Human (GRCh38)
Location 9:63138403-63138425 9:63138426-63138448
Sequence CCATTAACCACCCGTCTATCCAC ATATCACCCCTTGGCTGGGGTGG
Strand - +
Off-target summary No data {0: 9, 1: 0, 2: 1, 3: 8, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!