ID: 1054420349_1054420360

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1054420349 1054420360
Species Human (GRCh38) Human (GRCh38)
Location 9:64922792-64922814 9:64922841-64922863
Sequence CCAGGCATGGTGGCTCACGCCTG ATGGGTAAATCATCTGAGGTCGG
Strand - +
Off-target summary {0: 7414, 1: 43495, 2: 117154, 3: 175476, 4: 212017} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!