ID: 1054420352_1054420360

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1054420352 1054420360
Species Human (GRCh38) Human (GRCh38)
Location 9:64922811-64922833 9:64922841-64922863
Sequence CCTGTAATCCCAGCACCTTGGGA ATGGGTAAATCATCTGAGGTCGG
Strand - +
Off-target summary No data {0: 4, 1: 5, 2: 33, 3: 600, 4: 5051}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!