ID: 1054420355_1054420360

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1054420355 1054420360
Species Human (GRCh38) Human (GRCh38)
Location 9:64922820-64922842 9:64922841-64922863
Sequence CCAGCACCTTGGGAGGCTGAGAT ATGGGTAAATCATCTGAGGTCGG
Strand - +
Off-target summary {0: 41, 1: 2733, 2: 41991, 3: 167483, 4: 365929} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!