ID: 1054543136_1054543141

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1054543136 1054543141
Species Human (GRCh38) Human (GRCh38)
Location 9:66288659-66288681 9:66288681-66288703
Sequence CCACAGACACTCAACACCAGCCC CACAAAAGCAGCCAGAAGGCAGG
Strand - +
Off-target summary {0: 134, 1: 379, 2: 751, 3: 1024, 4: 1402} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!