ID: 1054810304_1054810308

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1054810304 1054810308
Species Human (GRCh38) Human (GRCh38)
Location 9:69429019-69429041 9:69429041-69429063
Sequence CCTTTAGGTGAACATACATAACC CGTTATGTGCAGGTTGTACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 71} {0: 1, 1: 0, 2: 0, 3: 0, 4: 61}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!