ID: 1055079488_1055079494

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1055079488 1055079494
Species Human (GRCh38) Human (GRCh38)
Location 9:72255199-72255221 9:72255226-72255248
Sequence CCTGCTTTCAATTACATGCAAAT GGGTGGGTGGATGCAAATTGAGG
Strand - +
Off-target summary {0: 1, 1: 29, 2: 133, 3: 222, 4: 493} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!