ID: 1055638911_1055638918

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1055638911 1055638918
Species Human (GRCh38) Human (GRCh38)
Location 9:78304221-78304243 9:78304262-78304284
Sequence CCCCATCTTCTGGCTCTGCTTTC GGGTGGCCACCATTGGTTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 12, 3: 60, 4: 631} {0: 1, 1: 0, 2: 0, 3: 7, 4: 88}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!