ID: 1055757607_1055757617

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1055757607 1055757617
Species Human (GRCh38) Human (GRCh38)
Location 9:79572628-79572650 9:79572644-79572666
Sequence CCTGCCGCCCGTGTCACGCGAGA CGCGAGACCCGGCGGGGGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 26} {0: 1, 1: 0, 2: 0, 3: 21, 4: 181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!