ID: 1056061175_1056061186

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1056061175 1056061186
Species Human (GRCh38) Human (GRCh38)
Location 9:82886090-82886112 9:82886142-82886164
Sequence CCATGTCCCATCTGTGTGACCCC GCAGCCACTCCCAGAGCCCCTGG
Strand - +
Off-target summary No data {0: 499, 1: 274, 2: 95, 3: 106, 4: 556}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!