ID: 1056068686_1056068691

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1056068686 1056068691
Species Human (GRCh38) Human (GRCh38)
Location 9:82963575-82963597 9:82963609-82963631
Sequence CCCTTATCATTGTTCTTAGACCC CTCCTGGATCCTTCTCTGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 134} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!