ID: 1056078143_1056078153

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1056078143 1056078153
Species Human (GRCh38) Human (GRCh38)
Location 9:83062528-83062550 9:83062577-83062599
Sequence CCGCCGCCGCGTCCTCGTCGCCT CGGCCCCGCCTCAGACACGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 232} {0: 1, 1: 0, 2: 0, 3: 14, 4: 221}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!