ID: 1056078144_1056078149

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1056078144 1056078149
Species Human (GRCh38) Human (GRCh38)
Location 9:83062531-83062553 9:83062557-83062579
Sequence CCGCCGCGTCCTCGTCGCCTTCG TCCTCGCTGTCGTGTGTCTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 129} {0: 1, 1: 0, 2: 0, 3: 4, 4: 71}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!