ID: 1056143460_1056143461

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1056143460 1056143461
Species Human (GRCh38) Human (GRCh38)
Location 9:83707266-83707288 9:83707279-83707301
Sequence CCGAGAAAAGCGGCATCAGCCCG CATCAGCCCGTCCCACAAACAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 11, 4: 67}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!