ID: 1056260298_1056260301

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1056260298 1056260301
Species Human (GRCh38) Human (GRCh38)
Location 9:84841836-84841858 9:84841889-84841911
Sequence CCTAAAACAGTTCATTGTAATAA AACATCCCAGGTTGAATCTAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 36, 4: 398} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!