ID: 1056273948_1056273959

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1056273948 1056273959
Species Human (GRCh38) Human (GRCh38)
Location 9:84974792-84974814 9:84974844-84974866
Sequence CCTTGCCTTATCCCTGCTGGCTT CGCCGGCTGTTTGGGAGTTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 281} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!