ID: 1056273951_1056273959

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1056273951 1056273959
Species Human (GRCh38) Human (GRCh38)
Location 9:84974804-84974826 9:84974844-84974866
Sequence CCTGCTGGCTTCAGCTTTCCCTA CGCCGGCTGTTTGGGAGTTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 97, 4: 633} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!