ID: 1056499065_1056499068

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1056499065 1056499068
Species Human (GRCh38) Human (GRCh38)
Location 9:87190179-87190201 9:87190204-87190226
Sequence CCTGTGTCCAGGTGCAGTGACTC ACCTGTAATCCCAGCACTTTGGG
Strand - +
Off-target summary No data {0: 71908, 1: 300079, 2: 246221, 3: 151210, 4: 174122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!