|
Left Crispr |
Right Crispr |
Crispr ID |
1056499065 |
1056499074 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
9:87190179-87190201
|
9:87190216-87190238
|
Sequence |
CCTGTGTCCAGGTGCAGTGACTC |
AGCACTTTGGGAGGCCAAGGTGG |
Strand |
- |
+ |
Off-target summary |
No data |
{0: 55360, 1: 145174, 2: 158991, 3: 100124, 4: 51656} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|