ID: 1056499065_1056499075

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1056499065 1056499075
Species Human (GRCh38) Human (GRCh38)
Location 9:87190179-87190201 9:87190217-87190239
Sequence CCTGTGTCCAGGTGCAGTGACTC GCACTTTGGGAGGCCAAGGTGGG
Strand - +
Off-target summary No data {0: 28733, 1: 128252, 2: 230554, 3: 215949, 4: 130370}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!