ID: 1056499065_1056499076

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1056499065 1056499076
Species Human (GRCh38) Human (GRCh38)
Location 9:87190179-87190201 9:87190220-87190242
Sequence CCTGTGTCCAGGTGCAGTGACTC CTTTGGGAGGCCAAGGTGGGAGG
Strand - +
Off-target summary No data {0: 21198, 1: 71365, 2: 150513, 3: 157804, 4: 132965}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!