ID: 1056514828_1056514831

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1056514828 1056514831
Species Human (GRCh38) Human (GRCh38)
Location 9:87340296-87340318 9:87340317-87340339
Sequence CCATCACCTGGGGTATCAAAAAG AGAGAAAGGAAAAAAGCAAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 93} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!