ID: 1056535934_1056535936

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1056535934 1056535936
Species Human (GRCh38) Human (GRCh38)
Location 9:87527689-87527711 9:87527724-87527746
Sequence CCTAATGTTTTCTTTGGACAGTT GCTTCTTTCTGAACTGTTACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 68, 4: 785} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!