ID: 1056606848_1056606856

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1056606848 1056606856
Species Human (GRCh38) Human (GRCh38)
Location 9:88093025-88093047 9:88093057-88093079
Sequence CCTCCACAAATCCCCTTAAAAAC GAACCCCTCAATGAAATGAGAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 4, 3: 17, 4: 256} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!