ID: 1056721032_1056721036

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1056721032 1056721036
Species Human (GRCh38) Human (GRCh38)
Location 9:89072210-89072232 9:89072252-89072274
Sequence CCTTGTGGAAAGACACAAATGTG GACCTTGAGCTGCTTATGACAGG
Strand - +
Off-target summary {0: 6, 1: 6, 2: 12, 3: 42, 4: 276} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!