ID: 1056765256_1056765265

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1056765256 1056765265
Species Human (GRCh38) Human (GRCh38)
Location 9:89441209-89441231 9:89441245-89441267
Sequence CCAAACTCCCAGACCTTACGAAT CTCCGCTTCCACACACGCGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 186} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!