ID: 1056805542_1056805555

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1056805542 1056805555
Species Human (GRCh38) Human (GRCh38)
Location 9:89726120-89726142 9:89726171-89726193
Sequence CCCAATCACCCAAACACCCCCAG CTGCCTTTCCACTGCCAGGCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!