ID: 1056865320_1056865332

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1056865320 1056865332
Species Human (GRCh38) Human (GRCh38)
Location 9:90223636-90223658 9:90223686-90223708
Sequence CCATTCCACCCCTCCCTCGGCAG AAATGCCCCTGAGAGAGCAGCGG
Strand - +
Off-target summary No data {0: 41, 1: 15, 2: 11, 3: 34, 4: 270}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!