ID: 1056941674_1056941686

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1056941674 1056941686
Species Human (GRCh38) Human (GRCh38)
Location 9:90961544-90961566 9:90961593-90961615
Sequence CCTGGAGCGTTTCTGCCGACAGC TTTGCAGGTTCTGGGCATGATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!