ID: 1057014273_1057014281

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1057014273 1057014281
Species Human (GRCh38) Human (GRCh38)
Location 9:91637125-91637147 9:91637176-91637198
Sequence CCATCCTTCTACCTTCAGTATAT ATTTATGCTCTATCAATAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 57, 4: 650} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!