ID: 1057162262_1057162269

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1057162262 1057162269
Species Human (GRCh38) Human (GRCh38)
Location 9:92896821-92896843 9:92896851-92896873
Sequence CCAGGTCCCCACTGACTAGGCTT CTAGGTCACCAGGTCCCCATTGG
Strand - +
Off-target summary {0: 6, 1: 0, 2: 0, 3: 48, 4: 190} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!