ID: 1057171153_1057171164

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1057171153 1057171164
Species Human (GRCh38) Human (GRCh38)
Location 9:92963975-92963997 9:92964024-92964046
Sequence CCCTCCTCCCTGAAGATCTACAC CAGCAGAAGCAGGAGGATGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 175} {0: 1, 1: 1, 2: 14, 3: 97, 4: 865}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!