ID: 1057240228_1057240235

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1057240228 1057240235
Species Human (GRCh38) Human (GRCh38)
Location 9:93401122-93401144 9:93401167-93401189
Sequence CCTTCAGTTCTCACCTCTTCAAT CCGCCTTTGCAGAGGGTGGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 12, 4: 190}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!