ID: 1057387681_1057387684

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1057387681 1057387684
Species Human (GRCh38) Human (GRCh38)
Location 9:94618865-94618887 9:94618918-94618940
Sequence CCATTGACAGAGGCAAGTGGACA CCAGTTTACCAGCACATCACTGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 14, 3: 37, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!