ID: 1057445006_1057445011

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1057445006 1057445011
Species Human (GRCh38) Human (GRCh38)
Location 9:95107641-95107663 9:95107666-95107688
Sequence CCACGCAGTCAGACCTCCGCCGA CAGTGTTCCCATACGAATGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 26} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!