ID: 1057557905_1057557914

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1057557905 1057557914
Species Human (GRCh38) Human (GRCh38)
Location 9:96102276-96102298 9:96102325-96102347
Sequence CCAATCATGACAGAAGGCCAGGG CAGAAGGAGAAGAAGGAGGCCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 11, 3: 268, 4: 2118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!