ID: 1057613537_1057613538

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1057613537 1057613538
Species Human (GRCh38) Human (GRCh38)
Location 9:96567627-96567649 9:96567640-96567662
Sequence CCATTTAAAATTATTGTAGAGAT TTGTAGAGATAGAGAGTAGAAGG
Strand - +
Off-target summary No data {0: 3, 1: 3, 2: 56, 3: 380, 4: 1203}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!