ID: 1057666512_1057666517

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1057666512 1057666517
Species Human (GRCh38) Human (GRCh38)
Location 9:97050054-97050076 9:97050074-97050096
Sequence CCAGGCATAGTGGCATGTGCCTG CTGTAGGCCCAGCTATAGGGAGG
Strand - +
Off-target summary {0: 134, 1: 2731, 2: 12574, 3: 40765, 4: 100148} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!