ID: 1057995727_1057995737 |
View in Genome Browser |
Spacer: 0 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1057995727 | 1057995737 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 9:99820531-99820553 | 9:99820554-99820576 |
Sequence | CCCTCGGCGCAGCGCCCCCCGCC | CCCGCCACACACACACAAATTGG |
Strand | - | + |
Off-target summary | No data | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |