ID: 1058058808_1058058816

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1058058808 1058058816
Species Human (GRCh38) Human (GRCh38)
Location 9:100474116-100474138 9:100474150-100474172
Sequence CCCAGGCAGGGATCTGTGTGTGT GCGGTGGGTGGGAGACGGCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 43, 4: 411} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!