ID: 1058137704_1058137711

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1058137704 1058137711
Species Human (GRCh38) Human (GRCh38)
Location 9:101325734-101325756 9:101325781-101325803
Sequence CCGAGTCCACATCTTTTCATGGG TCTGGTTTAAGGGATGCTGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 7, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!