ID: 1058143191_1058143202

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1058143191 1058143202
Species Human (GRCh38) Human (GRCh38)
Location 9:101380299-101380321 9:101380325-101380347
Sequence CCTTTCCCTATGGTATATCAACC GGTCTGGGGAGTAACAGTGAGGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 16, 3: 64, 4: 154} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!