ID: 1058175902_1058175906

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1058175902 1058175906
Species Human (GRCh38) Human (GRCh38)
Location 9:101737185-101737207 9:101737206-101737228
Sequence CCCTCAGACTTTACCAAGCCGTT TTTTCTCTCCCCTCATGCAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 47} {0: 1, 1: 0, 2: 1, 3: 19, 4: 241}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!