ID: 1058175902_1058175907

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1058175902 1058175907
Species Human (GRCh38) Human (GRCh38)
Location 9:101737185-101737207 9:101737212-101737234
Sequence CCCTCAGACTTTACCAAGCCGTT CTCCCCTCATGCAATGGCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 47} {0: 1, 1: 0, 2: 2, 3: 14, 4: 144}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!